ENCGM224GHI
Summary
- Status
- released
- Description
- This construct was made using the Human RP11 BAC library, derived from male whole blood, and contains a Localization and Affinity Purification (LAP) tag at the C-terminal of NFE2L1. The last 50 bases before the stop codon of NFE2L1 are as follows: CCGACCAGCAGGCCCGGCGGCAGGAGAGGAAGCCAAAGGACCGGAGAAAG
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- NFE2L1-human
- Coordinates
- hg19 chr17:45995801-46223194
Modification method
- Nucleic acid delivery method
- stable transfection
- Reagents