ENCGM322TZH
Summary
- Status
- released
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- THAP7-human
Modification method
- Method
- CRISPR
- Guide RNAs
- GGTCAGTCCAGCAGCCCCTCAGG
Documents
Sanger sequencing Characterization
Caption excerpt: Sanger DNA sequence electropherogram from an integration-specific PCR with 1)…
- Lab
- Michael Snyder, Stanford
- Submitter comment
- Sanger DNA sequence electropherogram from an integration-specific PCR with 1) eGFP-specific primer and 2) TF-specific primer as validation for the correct insertion of eGFP downstream of the homology arm and upstream of the transcription factor that is tagged. 02A_A2_THAP7-rep1_THAP7.ab1 is the rep1 sequence from the THAP7 specific primer, upstream from the homology arm used in the donor, and should be considered paired with the additional characterization containing 02E_A2_THAP7-rep1_lap.seq.1.ab1 which is the sequence from the GFP.
Sanger sequencing Characterization
Caption excerpt: Sanger DNA sequence electropherogram from an integration-specific PCR with 1)…
- Lab
- Michael Snyder, Stanford
- Submitter comment
- Sanger DNA sequence electropherogram from an integration-specific PCR with 1) eGFP-specific primer and 2) TF-specific primer as validation for the correct insertion of eGFP downstream of the homology arm and upstream of the transcription factor that is tagged. 02E_A2_THAP7-rep1_lap.seq.1.ab1 is the sequence from the GFP, and should be considered paired with the additional characterization containing 02A_A2_THAP7-rep1_THAP7.ab1 which is the rep1 sequence from the THAP7 specific primer, upstream from the homology arm used in the donor.