ENCGM325SHL
Summary
- Status
- released
- Type
- insertion
- Tags
- eGFP — C-terminal
- Purpose
- tagging
Modification site
- Target
- CAMTA2-human
Modification method
- Method
- CRISPR
- Guide RNAs
- CCAGGTCATGTGGCCAGTCCCGG
- Reagents
Documents
Sanger sequencing Characterization
Caption excerpt: Sanger DNA sequence electropherogram from an integration-specific PCR with 1)…
- Lab
- Michael Snyder, Stanford
- Submitter comment
- Sanger DNA sequence electropherogram from an integration-specific PCR with 1) eGFP-specific primer and 2) TF-specific primer as validation for the correct insertion of eGFP downstream of the homology arm and upstream of the transcription factor that is tagged. 06E_E8_CAMTA2_rep_1_CAMTA2.ab1 is the rep1 sequence from the CAMTA2 specific primer, upstream from the homology arm used in the donor, and should be considered paired with the additional characterization containing 08E_E8_CAMTA2_rep_1_lap.seq.1.ab1 which is the sequence from the GFP.
Sanger sequencing Characterization
Caption excerpt: Sanger DNA sequence electropherogram from an integration-specific PCR with 1)…
- Lab
- Michael Snyder, Stanford
- Submitter comment
- Sanger DNA sequence electropherogram from an integration-specific PCR with 1) eGFP-specific primer and 2) TF-specific primer as validation for the correct insertion of eGFP downstream of the homology arm and upstream of the transcription factor that is tagged. 08E_E8_CAMTA2_rep_1_lap.seq.1.ab1 is the rep1 sequence from the CAMTA2 specific primer, upstream from the homology arm used in the donor, and should be considered paired with the additional characterization containing 06E_E8_CAMTA2_rep_1_CAMTA2.ab1 which is the sequence from the GFP.